milcabruhxd4
milcabruhxd4 milcabruhxd4
  • 26-04-2018
  • Mathematics
contestada

What are the coordinates of C’ of the image?

What are the coordinates of C of the image class=

Respuesta :

sqdancefan
sqdancefan sqdancefan
  • 26-04-2018
The coordinates of C' are 3 times those of C.
  3×(2, -1) = (6, -3)

The appropriate selection is ...
  (6, -3) . . . . . . . . . the 4th one
Answer Link

Otras preguntas

What educational level, age and econimic status of the audience do I reach when talking bout geriatric offices
What happens as genes are passed on from parent to offspring over many generations?
(TCO 4) Which of the following creates thymine dimers? (Points : 4) Nucleotide analogs Nitrous acid Ultraviolet light Benzopyrene Gamma rays
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Which muscle below is a 2nd class lever? A) Gastrocnemius B) Biceps Brachii C) Flexor carpi ulnaris D) Extensor carpi ulnaris
Write a recursive function for this sequence 8,12,18,27..
PLEASSE HELP ME WITH THIS
what does hafa adai mean in guamanian
I need somebody's help..
Can someone help me with this problem... #20