UnknownOne UnknownOne

24-02-2017
Spanish

contestada

which of the following is not a major industry in San Cristobal Venezuela? coffee sugar leather tobacco

Respuesta :

katella200 katella200

24-02-2017

I believe leather is the answer

Answer Link

Otras preguntas

We want to find the zeros of this polynomial: p(3) = (x + 2)(2x - 3)(3-3) Plot all the zeros (x-intercepts) of the polynomial in the interactive graph

, hi knjilopjpoooooiiioooooooooooooooooooooooooooooooooooooooooo

What is the purpose of USA patriot act?

2. You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’. template DNA 3’ CCTACGGTTCGTACCCCGTA

What is the volume of the right triangular prism? 15 ft? 30 ft 150 ft 300 ft

PLZ HELP FAST The idea that the brain is adaptable and can change and learn new things is called: Fixed Mindset Growth Mindset Neuroplasticity

1. As Commander in Chief of the Army and Navy, I have directed that all measures be taken for our defense. But always will our whole nation remember the charact

PLEASE HELP 10TH GRADE GEOMETRY

which best way can I begin my writing my letter to the press

HELP PLEASEEEE Butterflies moved from mainland Australia to into the Indonesian archipelago. For almost every new island colonized, the butterflies adapted to t