alexuskipsang alexuskipsang

23-03-2022
Biology

contestada

5. Why did the students use such a large number of tadpoles (100 in each tank) in The class experiment?

5 Why did the students use such a large number of tadpoles 100 in each tank in The class experiment class=

Respuesta :

gamenation3304 gamenation3304

23-03-2022

They put 100 tadpoles in each tank to see which tank of tadpoles would thrive the best with different amounts of fertilizer

Answer Link

Otras preguntas

On May 3, what is the balance of the Equipment Office account? A. Debit $5,090 C. Debut $4,400 B. Debit $690 D. Credit $5.090

Plz help me with this

please help me asap ty..

Kari needs to change the brightness and contrast on an image she has inserted into a Word document. Which group should she use to do this? Adjust Picture Styles

1.(01.01) Evaluate -6 - (-1). (1 point) 5 -5 6

The area of a rectangular pool is 5628 m^(2). If the width of the pool is 67m, what is its length?

what statement about the data in the table is true? - answer correct for brainliest pls:)

stainlesssteel-group.es tuberãa de acero inoxidable

A student randomly draws a card from a standard deck and checks.

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):