babydee30 babydee30

26-04-2021
Mathematics

contestada

What is the value of the expression 2 + 7 + 49 - 6)2 + 6?

Respuesta :

26-04-2021

Answer:

416

Step-by-step explanation:

2+7+49-6=52

2+6=8

52*8=416

Answer Link

Otras preguntas

What would you be most likely to measure by immersing an object in water and seeing how much the water level rises

Oraciones con la palabra inspirar

DNA tacaggtacccgaacccaattta

Siddhartha Gautama is now more commonly known by what name? Select the best answer from the choices provided. A. Chandragupta Maurya B. Emperor Wu C. The B

Please help!! I don't understand this!

Describe how Computer Generated Imagery works. How has it benefited animation?

Andrea draws a polygon. The sum of the interior angles is 60 times the number of sides. How many sides does the polygon have?

2. Now that you have explored the general Romantic traits of Whitman’s and Dickinson’s poems and considered their styles, focus on a subject about which both po

The graph shows the number of laps kailee ran around a track over a given number of minutes.(a) What is the slope of the line? Use the slope formula and show yo

Select the answer that best completes the sentence. __________ mochila es negra. La El Los Las 2. Select the answer that best completes the sentenc