parrishkollin04 parrishkollin04

25-04-2021
Chemistry

contestada

balance Al2O3 + NaOH + H2O = NaAl(OH)4

Respuesta :

zidaneboussofi2005 zidaneboussofi2005

25-04-2021

Answer:

Al₂O₃ + 2 NaOH + 3 H₂O = 2 NaAl(OH)₄

Answer Link

Otras preguntas

In the diagram below of triangle EFG, H is the midpoint of EG and I is the midpoint of FG. If HI = -7+3x, and EF-2x + 34, what is the measure of EF?

Which of the following could cause a company to have a high ratio of cash to noncash assets? a. Highly volatile operations. b. Low dividend payments. c. Signifi

The slop of the graphed line is 2/3

"Evaluate definite integrals using Part 2 of the Fundamental Theorem of Calculus combined with Substitution.+ 1 Evaluate the definite integral 1x8 dx. 01 + x Gi

Question 6 (5 points) A Tesla car weighs 250,000 Newtons Travels a distance of 64 M in 2 seconds (115 km / hour). The Voltage of the Battery of the car is 375 V

at its closest approach, what will be the distance (in pc) to barnard’s star?

Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A:

find C on the directed line segment AB with A(-2, 6) and B(8,1) such that AC:CB = 2:3

6,7 I beg you please write letters and symbols as clearly as possible or make a key on the side so ik how to properly write out the problem D 6) Find the deriva

Read the following statement from the "Preamble." The peoples of the U.N. are determined to promote social progress and better standards of life. Which of the f