morganwatson0011 morganwatson0011
  • 23-04-2021
  • English
contestada

the great gatsby nick describes the land that lies in between the eggs and new york city as a

Respuesta :

saarymshafiq
saarymshafiq saarymshafiq
  • 23-04-2021

Answer:

He describes it as desolate

Explanation:

"The Valley of Ashes is halfway between West Egg and New York City. It is described as desolate, and there are ashes and smoke everywhere. There is a billboard from an old optometrist, ​the eyes of Dr. T.J. Eckleburg​that watch over everything below"

Answer Link

Otras preguntas

Which best describes how the human circulatory and respiratory systems interact.
what is the value of acceleration due to gravity g at the pole of earth​
Miriam has 3 packages of pencils. Each package has 6 pencils. She needs an eraser for each pencil. How many erasers will she need to buy? Tell which OPERATIONS
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
The goal of the ____ memory allocation algorithm is to find the smallest memory block into which a job will fit.
Why does the lawmaking process take so long?
Which BEST explains how the island on the lake most likely formed?
20x+10x-8=0 solution set of equation
16,40 and 56 LCMSolve please​
how many grams are in 1.35 moles of NH3