zwn80471 zwn80471
  • 26-03-2021
  • Mathematics
contestada

The question is in this link (please fast):

The question is in this link please fast class=

Respuesta :

MathJunkie24
MathJunkie24 MathJunkie24
  • 26-03-2021

Answer:

a) 190

b)-189

Step-by-step explanation:

4a)

-2y+7(4+8y)=

-2y+(7·4)+(7·8y)=

-2y+28+(7·8y)=

-2y+28+(7·24)

-2y+28+168=

-6+28+168=

22+168 solve

4b)

-5w-4(6t+5)

-5w-4(36+5)

-5w-(4·41)

-5w-164

-25-164 solve

Answer Link

Otras preguntas

Use the position-time graph below to answer the following questions. 1.Sketch the velocity-time graph that corresponds to this position-time graph.2. What is th
Answer this question as honestly as you can. I want to hear from you guys. I will report nonsense answers * PLEASE DO NOT TAKE THIS QUESTION DOWN! *Use the comm
Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I
What did the federal reserve do in the 1930’s
Переказ текста Книжкова Хвилинка. Даю 30 балів
"Every choice you make changes you." What does this mean in (1 paragraph)? Someone PLEASE HELP!
Which rapper is better... A. Eazy E B.Ice Cube C.NLE Choppa
PLEASE HELP!!!!!!!!!
ethos, logos, parallelism or pathos for 9 if 10 is wrong please tell me
in lather and nothing else was it easy of difficult to act with integrity.