tanyasingh21 tanyasingh21

26-03-2021
Biology

contestada

Help me plz asap 2-4 plz

Help me plz asap 24 plz class=

Respuesta :

annaclaire946 annaclaire946

26-03-2021

Answer:

1.mRNA- ATGAAAAGGTCCGTGGGAACTAAACAACACTAA

2.MRNA- ATGAAAACGGTCCGTGGGAACTAAACAACACTAA

3. ??

4. It will affect the protein so the leg wont have enough protein or have too much.

Explanation:

Answer Link

Otras preguntas

(-1,-4) and (6,10) x intercept write as ordered paid

two vehicles have a head on collision. one vehicle has a mass of 3000 kg and moves at 25 m/s while the second vehicle has a mass of 2500 kg and moves at -15 m/s

When Maritza Toros opened her Mexican restaurant in a fashionable suburb of Kansas City, she believed that the most important element of her success would be pr

Estimate each product. 28.21 x 8.02

What is 4/4 as a decimal

Nadia says the hypotenuse of this right triangle has a length of 73 because the Pythagorean theorem states that (28+45)^2=73^2.Which best describes Nadia’s solu

A precision instrument is guaranteed to be accurate to within 2 units. A sample of four instrument readings on the same object yielded the measurements 352, 350

Suppose that the U.S. government decides to charge wine consumers a tax. Before the tax, 45,000 bottles of wine were sold every week at a price of $4 per bottle

Assume that you have a direct-mapped cache with 16 one-word blocks that is initially empty, and that you will be given a series of word address references in th

8 A static load test has been conducted on a 60 ft long, 16 in square reinforced concrete pile which has been driven from a barge through 20 ft of water, then 3