noahethanarthurs noahethanarthurs

23-03-2021
Mathematics

contestada

Find the distance between the two points in simplest radical form.
(-2, 1) and (-8, 9)

Respuesta :

rijarafiquee rijarafiquee

23-03-2021

Answer:

10

Step-by-step explanation:

d = √(x2 - x1)² + (y2 - y1)²

d = √(-8 - -2)² + (9 - 1)²

d = √(-6)² + (8)²

d = √(36) + (64)

d = √100

d = 10

Answer Link

Otras preguntas

help me please please

what was different about world war I in comparison to previous wars?a, it was old-school war meets new technologyb, all the technology fit right into the old s

Read the excerpt from Martin Luther King Jr.’s "I Have a Dream” speech. But one hundred years later, the Negro still is not free. One hundred years later, the l

Question 7 of 10 What are the three main parts to a slide presentation's structure? A. Thesis statement, supporting evidence, and concluding quotes B. Main idea

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

Formulate a hypothesis based on something recently observed. And How could this hypothesis be tested?

1 generation of peas contains 20 individuals. 10 have the genotype YY and 10 have the genotype yy. In the following generation, 5 are YY, 10 are Yy and 5 are yy

Explain and discuss in relation to the SRA Code of Conduct for Solicitors 2019 and the ethical dilemmas faced by solicitors.

A varies jointly as of the product of b and c. If a = 24 when b = 8 and c = 2, find b when a = 48 and c = 4.

what type of government did Russia have in ww2