bailey1920072 bailey1920072

26-02-2021
Mathematics

contestada

Out of a group of 3 people, 2 study French and 1 studies Spanish. Two people are drawn randomly from the group without replacement. Display all possible outcomes as an organized list.

Respuesta :

emma020 emma020

26-02-2021

Answer:

- 1 French, 1 Spanish

- 2 French

Answer Link

Otras preguntas

4. PCR Primer design (4 points) You have a piece of DNA that includes the sequence: 5'GATGAGGATGAGGAGAAGTACCGGCCGCCGCCTGCGCATCACAATATGTTCAGT 3' To amplify this

People of color make up approximately ________ percent of members of the American Psychological Association.

Which of the following drugs, if used as part of the medical regimen, would have had a beneficial effect on calcium homeostasis and reduced:A) AntidepressantsB)

What considerations should a nurse be aware of when a client is prescribed oral fluconazole (Diflucan) as prophylaxis against fungal infections (mycoses)?

What was the harlem renaissance?O the explosion of african-american creativity and culture in new york city O artistic achievements of european immigrants in ne

The stream drops from 2000 feet above sea level to 1750 feet above sea level in a horizontal distance of 200 miles. calculate the stream gradient

1.f(x)=1/3x³ and g(x) = x². You may set the integrals up, then use your calculator to evaluate. a. Find the area between the intersection of the two curves. b.

Inside a 120m deep shaft, a stone is dropped without initial velocity a) what is the time of the fall of the first stone b)with what final speed does the 1 sto

Which compound did not produce a red or pink flame? a) lithium nitrate b) magnesium nitrate c) strontium nitrate d) calcium nitrate

Examine the system below and determine the equilibrium expression when N2O(g) is produced by decomposition of agricultural wastes by obligate aerobic bacteria.