06amanpreet 06amanpreet
  • 24-02-2021
  • Chemistry
contestada

The percentage of the earth’s atmosphere today is the same as it was in the earths early atmosphere. Suggest why.

Respuesta :

BeauV
BeauV BeauV
  • 24-02-2021

Explanation:

Once the earth's atmosphere was formed it really hasn't changed since, this is due to many reasons. Whatever created the earth's atmosphere (we don't know) has long disappeared, because of this the atmosphere cannot change, as there is nothing on earth that can change it (that we know of at least). Hopefully this helps.

Answer Link

Otras preguntas

how was sam houston passionate? give atleast 2 examples with explanation
what is thunder is cause by?
Which scientific advancement is linked to the Muslim scholar Al- Khwarizmi? O A. He discovered new species of life on the ocean floor. B. He developed a unified
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
What is the effect of using scaffold proteins on precision and amplification capacity in cell signaling?
what is thunder is cause by?
The election of 1800 demonstrated that the Alien and Sedition Acts were constitutional. the electoral college worked smoothly. the US government was stable. pre
in a beauty contest, half of the judges voted for miss.a .2\3 of them voted for miss.b., 10 voted for both and 6 did not vote for either miss.a or miss.b.find h
what is thunder is cause by?
what is the main point being made by the cartoonist documeny E