latifac latifac
  • 23-02-2021
  • Mathematics
contestada

What’s the correct answer

Whats the correct answer class=

Respuesta :

ghaliafatani ghaliafatani
  • 23-02-2021
7/9 x(5.6)


rounded 0


33.46
Answer Link

Otras preguntas

If private property rights were established in the air, there would probably be
Which of the following does Saturn have in common with Earth?
When earth completes a full rotation how many times has elapsed? (A) 1 day (B) 1 week (C) 1 month (D) 1 year
Is this statement true or false? The origins of rock and roll can be traced back to blues, gospel, and jazz music.
which individuals are at the highest risk of being victimized by drug traffickers
What type of force caused the folds shown in the above cross section
What is important when looking at a historical source
What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt
How did planetesimals form?
Compare and Contrast President Roosevelt's proposals with his opponents: Francis Townsend: Townsend's Old Age Revolving Pension Huey P. Long: Share Our Wealth P