lawsyaks
lawsyaks lawsyaks
  • 23-11-2020
  • Business
contestada

the term exchange in marketing mean?​

Respuesta :

raishiba321
raishiba321 raishiba321
  • 02-12-2020

Explanation:

i hope help you

follow me

Ver imagen raishiba321
Answer Link

Otras preguntas

Hey y'all!! please help me with this Simplify!!I really need this!!​
In some grassland ecosystems, lions are predators that consume zebras. In several estuary ecosystems, fish lice are parasites that consume the blood of fish. Ho
Need help please with this questions
list out the elements of data communication​
Solve the following: four and three tenths plus three and six tenths equals nine and seven tenths seven and nine tenths 7 four and nine tenths
HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT
In the heavy weight class of professional wresythe junior weight limit is 190 pounds this is 15 pounds heavier than the light heavy weight limit write and solve
Whos too cool 4 school, wasting all my crdits
In a triangle where side a = 15 inches, side b = 11 inches, and angle A = 30 degrees, what is angle C?
Determine the measures of all the angles in each diagram