maliahborders maliahborders

24-09-2020
History

contestada

using primary and secondary sources. Why is the passage a primary source

Respuesta :

jamiemolina72 jamiemolina72

24-09-2020

a primary source is like a poem or story that came from someone that was there when the event happend..

Answer Link

PartyGirl2552 PartyGirl2552

11-11-2020

Answer:

Its A ,took the test and it was correct

Answer Link

Otras preguntas

Point T is the Midpoint of JH. The coordinate of T is (0, 5) and the coordinate of J is (0, 2) The coordinate of H is

Which aspects of the Somme's geography might interest a modern factory owner?

PLEASE HELPP AND EXPLAIN!!

Which system of inequalities is represented on this graph? SOME ONE PLEASE HELP!!

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT

The Constitution establishes three branches of government that share identical powers. have different powers. are led by the legislative branch. are led by the

he equation below describes a proportional relationship between x and y. What is the constant of proportionality? y = 4/9x

Part A What is a central idea in the Newsela article "Washed-Up Plastics Become Art with a Vital Message"? Many people now look for trash to pick up when they

what is science?Answer:pls

The volume of a sample of gas measured at 65. 0°c and 1. 00 atm pressure is 2. 00 l. What must the final temperature be in order for the gas to have a final vol