nazhiaa87 nazhiaa87

21-09-2020
Mathematics

contestada

Find the distance between the two points in simplest radical form.
(1.5) and (-5,8)

Respuesta :

dgraff06 dgraff06

21-09-2020

Answer:

exact: 3 √ 5

decimal: 6.70820393 …

Hope this helps

Answer Link

Otras preguntas

Consumer surplus exists when a A. person buys something with a marginal benefit more than what they paid. B. producer sells something for more than it is worth.

The diameter of a circle is two units what is the radius of the circle?

A 10-year annual payment corporate bond has a market price of $1,050. It pays annual interest of $100 and its required rate of return is 9 percent. By how much

How did the United States get Florida

Energy which travels through space in the form of waves is known as

Paid persuasive communication that uses mass and interactive media to reach broad audiences to connect an identified sponsor with a target audience is known as

Write the base sequence of the complementary strand of double-helical DNA in which one strand has the sequence (5)ATGCGTAGCCTAGCCTAGTAGCCTTC(3). What is RNA seq

Name the Victorian state authority and health and safety regulator who manages Victoria’s workers compensation scheme? Briefly explain what this authority and h

A study is conducted to determine whether a new cancer drug increases the mean survival time by at least 30 days for a certain type of cancer. Explain in contex

Find θ, 0° ≤ θ < 360°, given the following information. sin θ = − 1/2 and θ in QIII θ = _________°