bbrittain04 bbrittain04
  • 23-05-2020
  • Biology
contestada

Need help ASAP it’s Science need it done right now

Need help ASAP its Science need it done right now class=

Respuesta :

guineapig666
guineapig666 guineapig666
  • 23-05-2020

Answer:

1. changing

2. ? its either fast or mechanical....Id have to see the back of the paper

3. slowly

4. weathering

5. mechanical.....chemical

6. mechanical

Explanation:

Answer Link

Otras preguntas

A parking lot in the shape of a trapezoid has an area of 12,052.1 square meters. The length of one base is 82.4 meters, and the length of the other base is 108.
PLEASE HELP ME ASAP 10 POINTS
When a cell related to immunity activates only in reaction to a specific pathogen, it is called _____. (Points : 4) inducibility clonality lymphocytes T lymphoc
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Deinonychus were relatively small predators of the early Cretaceous. Which of the following is true about this species? a. Their claws were likely adaptations f
Do any of these represent a linear function (just state letters if they do)
Which of the following ideas best fits with biological evolution by natural selection? 1.The most fit individuals are those with the highest reproductive succes
which of the following was a justification for the increase in US defense spending during the Cold War
The majority of people that Muhammad came into contact with were A:Monotheistic B:Polytheistic C:A mixture of both
write a sentence with the word labyrinth