Kaniyahdolo77 Kaniyahdolo77
  • 22-03-2020
  • Mathematics
contestada

evaluate this expression : 8(16)+8(6)

Respuesta :

Wallind11
Wallind11 Wallind11
  • 22-03-2020

Step-by-step explanation:

8(16)+8(6)

=128+48

=176

Answer Link

Otras preguntas

Select the correct answer. What was the first country to feel the effects of George W. Bush's approach to foreign affairs, referred to as the Bush Doctrine (or
Should children be tried as adults? (Juvenile Justice)
I need help asap like nowwwwwwwww
Sports physiologists at an olympic training center wanted to monitor athletes to determine at what point their muscles were functioning anaerobically. They coul
What expression is an equivalent form of the expression (n)−3? 1/n3 -3n -1/n3 3n
Mr Nolan drove 228 miles using 12 gallons of gasoline. What was his mileage per gallon? BRAINLIEST PLSSSSSSSSSSS ANSWER
Subject: Biology/Social Studies I need help with this! Thanks in advance
What is the value of x for the given equation for (5x+3)+(3x+7)
Andre says that x is 7 because he can move the two 1s with the x to the other side. Do you agree with Andre? Explain your reasoning Picture below:
HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT