trapPOP trapPOP
  • 21-11-2019
  • Geography
contestada

Name 3 rivers that are the most polluted in Europe

Respuesta :

naturalqveen
naturalqveen naturalqveen
  • 21-11-2019
Mekong, Tiber and Danube.
Answer Link

Otras preguntas

In algebra, we use a(n)_______to represent a variable.
We’d help with this one all
When a pollutant is removed from the air by a natural process it_____? Distrupts natural processes Ends up elsewhere Is gone forever Causes chemical reaction
What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt
The last common ancestor of all bilaterians is thought to have had four hox genes. most extant cnidarians have two hox genes, though some have three hox genes.
Select all that apply. betsie always had a loving response to those who hurt her, and she never showed unkindness. how was this possible, considering her circum
Which of the following is an example of a recently created word? A.) audiophile B.) mallet C.)befuddled D.)bibliography
Which describes self-actualization? A. a process for defining needs B. a person’s physical development C. a person’s emotional development D. a process for achi
H2O Cl2 NH3 What do all of these compounds have in common? A) They are all ionic. B) They are all covalent. C) They all are positively charged. D) They a
The diameter of a small gear is 16 cm this is 2.5 centimeters more than 1/4 of the diameter of a large clear what is the diameter of the larger gear