devinmiller16 devinmiller16

22-10-2019
History

contestada

Who was the first president lol 100 points.

Respuesta :

andrew8596 andrew8596

22-10-2019

Answer:

George Washington of U.S.

Rajenda Prasad of India

Louis-Napoléon Bonaparte of the French republic

Explanation:

Answer Link

amaserrano0526 amaserrano0526

22-10-2019

ANSWER:

George Washington

Ver imagen amaserrano0526

Answer Link

Otras preguntas

how to solve these question?

If 1+4=5; 2+5=12; 3+6==21; what is 8+11

What are the three differences between The Quran and the Gospel??

Why does Vivien say that she “shan't tell” Lancelot’s identity to her friend in King Arthur's Socks: A Comedy in One Act?

What did Anti-Federalists fear would happen if the Constitution became law?

182,886 rounded to the nearest tenth

Who is Barbare Sonek?

The number of cells in an average-sized adult human is on the order of 10^14 cells. Use this information, and the estimate that the length of DNA contained in e

Can somebody please explain to me how the acceleration in simple hormonic motion is proportional to the displacement..

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC