BluSeaa
BluSeaa BluSeaa
  • 22-08-2019
  • Mathematics
contestada

Solve for v in the proportion.

v/9 = 5/3

v =

Solve for v in the proportion v9 53 v class=

Respuesta :

Аноним Аноним
  • 22-08-2019

3*v= 3v

9*5= 45

3v= 45

divide by 3

3v/3= 45/3

v= 15

Answer Link
TheBlueFox
TheBlueFox TheBlueFox
  • 22-08-2019

Answer is provided int he image attached.

Ver imagen TheBlueFox
Answer Link

Otras preguntas

If it takes 41.72 J to he a piece of gold waiting 18.69 g from 10.0°C to 27°C what is the specific heat of gold
What's x² + 2x + 1 factorised?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
what happened when citric acid and and bicarbonate soda mixed together
Compare and contrast immune tolerance with licensing
Which muscle below is a 2nd class lever? A) Gastrocnemius B) Biceps Brachii C) Flexor carpi ulnaris D) Extensor carpi ulnaris
Frank uses improper body position to lift a heavy box and strains the muscles in his lumbar region. which muscles are most likely to be involved in this injury?
Make a word rearranging the following letters: C O P E S O R I M M
what would you call a object that makes people shut up
The heart sounds S1 and S2 are...?