selects1376 selects1376

23-01-2024
Social Studies

contestada

Injuring a person's character or reputation through writing is known as ________.
1) Libel
2) Slander
3) Negligence
4) Assault

Respuesta :

Otras preguntas

The moors make arrangements to hire how large a band for the graduation event

A price floor means that:______. a. inflation is severe in this particular market. b. sellers are artificially restricting supply to raise price. c. governme

I need to do a project on why iceland has the best economy can someone plz help me do it by 11:00a.m. I'll create a question for the person that helps me with

a historian who compares the expansion of political systems to the expansion of economic systems is organizing history by?

Which of the following statements about income and wealth distribution is true? (1 point) Inheritance distributes wealth more equally. A. Progressive tax makes

English language which is it is this right?

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provid

need help with this

How does speaking and writing differ?

From “The Wild Swans at Coole” I have looked upon those brilliant creatures, And now my heart is sore. All’s changed since I, hearing at twilight, The first tim